Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS413-GAL1-luc*(-SKL)
(Plasmid #40234)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40234 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS413
  • Backbone size w/o insert (bp) 1650
  • Total vector size (bp) 7314
  • Vector type
    Bacterial Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    luc*(-SKL)
  • Alt name
    Firefly luciferase
  • Alt name
    Photinus pyralis luciferase
  • Alt name
    luciferase, Fluc
  • Species
    Photinus pyralis
  • Insert Size (bp)
    1650
  • Promoter GAL1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SmaI (not destroyed)
  • 5′ sequencing primer CATCGACTGAAATCCCTGGT
  • 3′ sequencing primer ccctccgaaggaagactctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mumberg D, Muller R and Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122. Leskinen P, Virta M and Karp M (2003). One-step measurement of firefly luciferase activity in yeast. Yeast 20(13): 1109-1113. Bonin AL, Gossen M and Bujard H (1994). Photinus pyralis luciferase: vectors that contain a modified luc coding sequence allowing convenient transfer into other systems. Gene 141(1): 75-77.
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS413-GAL1-luc*(-SKL) was a gift from Michael Benton (Addgene plasmid # 40234 ; http://n2t.net/addgene:40234 ; RRID:Addgene_40234)