pRS413-GAL1-luc*(-SKL)
(Plasmid
#40234)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS413
- Backbone size w/o insert (bp) 1650
- Total vector size (bp) 7314
-
Vector typeBacterial Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameluc*(-SKL)
-
Alt nameFirefly luciferase
-
Alt namePhotinus pyralis luciferase
-
Alt nameluciferase, Fluc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1650
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SmaI (not destroyed)
- 5′ sequencing primer CATCGACTGAAATCCCTGGT
- 3′ sequencing primer ccctccgaaggaagactctc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMumberg D, Muller R and Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122. Leskinen P, Virta M and Karp M (2003). One-step measurement of firefly luciferase activity in yeast. Yeast 20(13): 1109-1113. Bonin AL, Gossen M and Bujard H (1994). Photinus pyralis luciferase: vectors that contain a modified luc coding sequence allowing convenient transfer into other systems. Gene 141(1): 75-77.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS413-GAL1-luc*(-SKL) was a gift from Michael Benton (Addgene plasmid # 40234 ; http://n2t.net/addgene:40234 ; RRID:Addgene_40234)