pRS413-GAL1-yEGFP1
(Plasmid #40235)

• Depositing Lab: Michael Benton
• Publication: pFA6-yEGFP1-HIS3MX6 (unpublished)

Backbone

• Vector backbone: pRS413
• Backbone size w/o insert (bp): 5667
• Total vector size (bp): 6381
• Vector type: Bacterial Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: yEGFP1
• Alt name: yeast Enhanced Green Fluorescent Protein
• Insert Size (bp): 714
• Promoter: GAL1
• Tag / Fusion Protein:
  • HIS3MX6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SmaI (not destroyed)
• 5′ sequencing primer: caagactggaccatcaccaa
• 3′ sequencing primer: ccctccgaaggaagactctc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Mumberg D, Muller R and Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122. Sheff MA and Thorn KS (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21(8): 661-670.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

yEGFP contains a M233I point mutation. Depositor states that this mutation does not affect yEGFP function.