-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEYFP-N1
-
Backbone manufacturerClontech
-
Modifications to backbonepcLINK is derived from pCAbeta (Doug Martin lab - Fukuchi et al., 1993) in which the beta-gal sequence NotI-ClaI has been removed and the MCS sequence GGCCGTCTCAGGCCGCCCGGGCGGATCCATTTAAATCTCGAGACT AGTATCGAT (XmaI-SmaI-BamHI-DraI-XhoI-SpeI-ClaI) was inserted.
-
Vector typechick expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedrebrin E2
-
SpeciesH. sapiens (human)
-
Entrez GeneDBN1 (a.k.a. D0S117E)
- Promoter chick B-actin promoter with CMV enhancer
-
Tag
/ Fusion Protein
- eYFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer NA
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
drebrin-YFP was a gift from Phillip Gordon-Weeks (Addgene plasmid # 40359 ; http://n2t.net/addgene:40359 ; RRID:Addgene_40359) -
For your References section:
Targeting of the F-actin-binding protein drebrin by the microtubule plus-tip protein EB3 is required for neuritogenesis. Geraldo S, Khanzada UK, Parsons M, Chilton JK, Gordon-Weeks PR. Nat Cell Biol. 2008 Oct;10(10):1181-9. Epub 2008 Sep 21. 10.1038/ncb1778 PubMed 18806788