p2.0VPI.EGFP
(Plasmid #40868)

• Depositing Lab: Harold Gainer
• Publication: Ponzio et al PLoS One. 2012;7(11):e48860. doi: 10.1371/journal.pone.0048860. Epub 2012 Nov 14.

Backbone

• Vector backbone: pFastBac1
• Vector type: Bacterial Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mouse vasopressin promoter
• Promoter: mouse vasopressin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba I (not destroyed)
• 3′ cloning site: Xba I (not destroyed)
• 5′ sequencing primer: CCTTGCTGTTCTTCTACGGCA
• 3′ sequencing primer: aagtttaacaacaacaattgca

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The following mutations are known and do not effect function: C6978-,AT722--, -5958C, G5896C, G5850-, C5834G, C5819-, A5682T, C5709-, -5647T, -5497C, T5371C.