PBAD-his6-prkA-pACYC184
(Plasmid #41041)

• Depositing Lab: Ichiro Matsumura
• Publication: Parikh et al Protein Eng Des Sel. 2006 Mar;19(3):113-9. Epub 2006 Jan 19.

Backbone

• Vector backbone: pACYC184
• Backbone manufacturer: ATCC
• Backbone size w/o insert (bp): 4245
• Total vector size (bp): 6211
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: prkA
• Alt name: PBAD-his6-prkA
• Alt name: phosphoribulokinase
• Species: Synechococcus elongatus PCC 7942
• Insert Size (bp): 2611
• GenBank ID: WP_011242879.1
• Promoter: PBAD
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert)
  • T7 epitope tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SphI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: pBAD-F (ATGCCATAGCATTTTTATCC)
• 3′ sequencing primer: p15A-F (gattacgcgcagaccaaaac)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PBAD-his6-prkA-pACYC184 confers resistance to working concentrations (~34 micrograms/mL) of chloramphenicol in E. coli. The copy number of the plasmid is relatively low because of its p15A origin.

Regarding its construction, the prkA gene was amplified in a PCR from whole Synechococcus PCC7942 cells using Vent polymerase and primers 5'SprkA (5'-GGGCCCGAGCTCGTCACTGTCTCGAGGGATCCTAT-3') and 3'SprkA (5'-CCGGGAAGCTTAGAGTCACACCGCTGAAAACAAGT-3'). The prkA gene was blunt-end cloned into EcoRV-cut pBS KS+, and sequenced to confirm its wild-type identity. It was subsequently subcloned into pET28a+ using restriction enzymes EcoRI and HindIII; this step fused the gene DNA sequence encoding an N-terminal hexa-histidine tag. The his6-prkA gene was subcloned into pBAD myc his A using restriction enzymes NcoI and HindIII. The araC-PBAD–his6-prkA expression cassette was subcloned into pACYC184 using SphI and HindIII. The final construct, PBAD-his6-prkA-pACYC184, contains the arabinose-inducible PBAD promoter, a fusion gene encoding a hexa-histidine-tagged phosphoribulokinase in the pACYC184 (low copy number, chloramphenicol-resistant) vector.

Plasmid features:

Type Start End Name

GENE 581 1493 p15A ori
GENE 2712 1567 6his-prkA
GENE 3048 3935 araC
GENE 5774 219 ChlR