pEF-Bos MAL Flag
(Plasmid #41554)

• Depositing Labs: Kate Fitzgerald, Tom Maniatis
• Publication: Fitzgerald et al Nat Immunol. 2003 May;4(5):491-6.

Backbone

• Vector backbone: pEF-Bos
• Backbone manufacturer: Mizushima and Nagata (Osaka Bioscience Institute, Japan, 1990) (PMID: 1698283)
• Backbone size w/o insert (bp): 5685
• Total vector size (bp): 6397
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MAL
• Alt name: TIRAP
• Alt name: MyD88 adapter–like protein
• Alt name: TIR domain–containing adapter protein
• Species: H. sapiens (human)
• Insert Size (bp): 712
• GenBank ID: NM_148910.2 NP_683708.1
• Entrez Gene: TIRAP (a.k.a. BACTS1, Mal, MyD88-2, wyatt)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • Flag (C terminal on backbone)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: EF-1aF
• 3′ sequencing primer: G-CSF-R (GATGGGGAACACTGCTGTTTA)

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositing lab generated pEF-Bos MAL Flag from a human peripheral blood mononuclear cell (PBMC) complementary DNA library by PCR amplification and cloning. It was cloned with XhoI at the 5' end and BamHI at the 3' end. NotI can be used at the 3' end to excise the tagged CDS. The depositor's provided sequence includes some flanking EF-BOS sequence. The construct also contains a HIS tag.