psiCheck-ApoE3'UTR
(Plasmid #41846)

• Depositing Lab: Sohail Tavazoie
• Publication: Pencheva et al Cell. 2012 Nov 21;151(5):1068-82. doi: 10.1016/j.cell.2012.10.028. Epub 2012 Nov 8.

Backbone

• Vector backbone: psiCheck2
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 6273
• Total vector size (bp): 6416
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ApoE 3'UTR
• Alt name: apolipoprotein E
• Species: H. sapiens (human)
• Insert Size (bp): 143
• Entrez Gene: APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho1 (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: GTACATCAAGAGCTTCGTGG
• 3′ sequencing primer: AAGACTCATTTAGATCCTCACAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Full-length 3′UTR of ApoE was cloned downstream of renilla luciferase reporter in the psiCheck2 dual luciferase reporter vector