pJN105-Hygro-GFP
(Plasmid #41883)

• Depositing Lab: Howard Steinman
• Publication: Bandyopadhyay et al Infect Immun. 2004 Aug;72(8):4541-51.

Backbone

• Vector backbone: pJN105
• Backbone size w/o insert (bp): 6050
• Modifications to backbone: Gentamicin resistance cassette replaced with hygromycin resistance fragment from pMV206.hygro
• Vector type: Bacterial Expression ; Bacterial broad host range vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ptac::GFP-mut-2
• Alt name: GFP-mut-2
• Alt name: GFP
• Species: A. victoria
• Mutation: GFP-mut-2 is GFP with Ser65Ala, Val68Leu, and Ser72Ala
• Promoter: Ptac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: pBAD-F (ATGCCATAGCATTTTTATCC)
• 3′ sequencing primer: M13_pUC_fwd

Resource Information

• A portion of this plasmid was derived from a plasmid made by: HygroR gene obtained by PC from pMV206.hygro, from William Jacobs, Jr., Albert Einstein College of Medicine, Bronx, New York. Ptac::GFP-mut-2 obtained by PCR from pGS-GFP04 from Howard Shuman, University of Chicago, Chicago, Illinois. (PMID: 11722729)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pBBR1MCS-5 derivative of the Bordetella bronchiseptica BHR plasmid has a pBBR/BHR replicon that is maintained in L. pneumophila and is compatible with IncP, IncW, IncQ, and IncRi incompatibility groups. Plasmid pJN105 is a derivative of pBBR1MCS-5 with araC and PBAD regions before the polylinker. PCR primers with BglII sites at their 5′ ends were used to amplify the region outside the gentamicin cassette in pJN105. The PCR fragment was digested with BglII, blunted with the Klenow fragment, and ligated to the blunted DdeI-DdeI hygromycin resistance fragment from pMV206.hygro to form pJN105-hygro. The Ptac-GFP fragment of pGS-GFP04 was amplified by PCR by using primers with NheI sites at their 5′ ends. After digestion with NheI, this fragment was ligated with NheI-digested pJN105-hygro to form pJN105-hygro-GFP.