Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmyc-GFP-TNRC6C-(928-1020)
(Plasmid #42026)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42026 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5338
  • Total vector size (bp) 6391
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TNRC6C
  • Species
    H. sapiens (human)
  • Mutation
    contain aa928-1020
  • GenBank ID
    NP_061869
  • Entrez Gene
    TNRC6C
  • Promoter CMV
  • Tags / Fusion Proteins
    • Myc (N terminal on insert)
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmyc-GFP-TNRC6C-(928-1020) was a gift from Kumiko Ui-Tei (Addgene plasmid # 42026 ; http://n2t.net/addgene:42026 ; RRID:Addgene_42026)
  • For your References section:

    Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. Nishi K, Nishi A, Nagasawa T, Ui-Tei K. RNA. 2013 Jan;19(1):17-35. doi: 10.1261/rna.034769.112. Epub 2012 Nov 13. 10.1261/rna.034769.112 PubMed 23150874