This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #42171)

Full plasmid sequence is not available for this item.

Item Catalog # Description Quantity Price (USD)
Plasmid 42171 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
    pBAD-His B
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4100
  • Total vector size (bp) 4800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter araBAD
  • Tag / Fusion Protein
    • 6His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGTCCCCTCTCTACTGTTTCTCCAT
  • 3′ sequencing primer CCCAAGGCGTTTCACTTCTGAGTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mAmetrine1.2 in an intensively engineered variant of GFP.
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmAmetrine1.2 was a gift from Robert Campbell (Addgene plasmid # 42171)
  • For your References section:

    Forster resonance energy transfer-based biosensors for multiparameter ratiometric imaging of Ca2+ dynamics and caspase-3 activity in single cells. Ding Y, Ai HW, Hoi H, Campbell RE. Anal Chem. 2011 Dec 15;83(24):9687-93. doi: 10.1021/ac202595g. Epub 2011 Nov 28. 10.1021/ac202595g PubMed 22080726