This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #42214)


Item Catalog # Description Quantity Price (USD)
Plasmid 42214 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4859
  • Total vector size (bp) 5026
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    9xSeq2 Binding Sites
  • Insert Size (bp)
  • Promoter 9 tandem copies of Seq2 + minimal human CMV promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CAGGTGCCAGAACATTTCTCT
  • 3′ sequencing primer GAGCTCTGCTTATATAGACCTCCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Binding site is AAACTGCAAAAG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Basic-9xSeq2-Luc was a gift from Charles Gersbach (Addgene plasmid # 42214 ; ; RRID:Addgene_42214)
  • For your References section:

    Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors. Polstein LR, Gersbach CA. J Am Chem Soc. 2012 Oct 10;134(40):16480-3. doi: 10.1021/ja3065667. Epub 2012 Sep 27. 10.1021/ja3065667 PubMed 22963237