pHes1(2.5k)-luc
(Plasmid #43806)

• Depositing Lab: Ryoichiro Kageyama
• Publication: Takebayashi et al J Biol Chem. 1994 Feb 18;269(7):5150-6.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	43806	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pGL2-Basic
  (Search Vector Database)
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5597
• Total vector size (bp): 8200
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hes1 Promoter
• Alt name: Hes1
• Alt name: hairy and enhancer of split 1 Promoter
• Alt name: hairy and enhancer of split 1
• Species: M. musculus (mouse)
• Insert Size (bp): 2500
• Mutation: Contains the murine Hes1 promoter
• GenBank ID: NC_000082.6
• Entrez Gene: Hes1 (a.k.a. Hry, bHLHb39)
• Promoter: Hes1 Promoter
• Tag / Fusion Protein:
  • Firefly luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: F1ori-F (GTGGACTCTTGTTCCAAACTGG)
• 3′ sequencing primer: LucNrev

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PGL2-Basic (under designation "Picagene Basic Vector") obtained from Toyo Ink (Tokyo, Japan).
• Terms and Licenses:
  • UBMTA
  • Luciferase Limited Use Label License
• Article Citing this Plasmid:
  • 1 Reference