Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUS_A4B
(Plasmid #43854)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 43854 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR8
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2447
  • Total vector size (bp) 2997

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacZ + BsaI restriction sites

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pCR8_F1 (ttgatgcctggcagttccct)
  • 3′ sequencing primer pCR8_R1 (cgaaccgaacaggcttatgt)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Yamamoto TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALEN/Yamamotolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUS_A4B was a gift from Takashi Yamamoto (Addgene plasmid # 43854 ; http://n2t.net/addgene:43854 ; RRID:Addgene_43854)
  • For your References section:

    Efficient TALEN construction and evaluation methods for human cell and animal applications. Sakuma T, Hosoi S, Woltjen K, Suzuki KI, Kashiwagi K, Wada H, Ochiai H, Miyamoto T, Kawai N, Sasakura Y, Matsuura S, Okada Y, Kawahara A, Hayashi S, Yamamoto T. Genes Cells. 2013 Feb 6. doi: 10.1111/gtc.12037. 10.1111/gtc.12037 PubMed 23388034