pFUS_A4B
(Plasmid
#43854)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43854 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2447
- Total vector size (bp) 2997
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacZ + BsaI restriction sites
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCR8_F1 (ttgatgcctggcagttccct)
- 3′ sequencing primer pCR8_R1 (cgaaccgaacaggcttatgt) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Yamamoto TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALEN/Yamamotolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUS_A4B was a gift from Takashi Yamamoto (Addgene plasmid # 43854 ; http://n2t.net/addgene:43854 ; RRID:Addgene_43854) -
For your References section:
Efficient TALEN construction and evaluation methods for human cell and animal applications. Sakuma T, Hosoi S, Woltjen K, Suzuki KI, Kashiwagi K, Wada H, Ochiai H, Miyamoto T, Kawai N, Sasakura Y, Matsuura S, Okada Y, Kawahara A, Hayashi S, Yamamoto T. Genes Cells. 2013 Feb 6. doi: 10.1111/gtc.12037. 10.1111/gtc.12037 PubMed 23388034