pXL-CAG-mBirA272-NRX3b
(Plasmid
#43921)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXL-CAG
- Backbone size w/o insert (bp) 6299
- Total vector size (bp) 8624
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBirA272-NRX3b
-
Alt nameNeurexin3b
-
Alt nameBirA
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2772
-
MutationSee comments
-
Entrez GenebirA (a.k.a. ECs_4900)
- Promoter CAG
-
Tag
/ Fusion Protein
- 2XFLAG
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCCCCTCTAGCGGGCGCGG
- 3′ sequencing primer TGTGAGCCAGGGCATTGGCCACACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
272 indicates the amino acid position that the BirA is inserted in for NRX3b. There is a single alanine deletion in BirA, which is a non-dimerizing mutation. The BirA and AILR insert regions of the plasmid is codon optimized.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXL-CAG-mBirA272-NRX3b was a gift from Alice Ting (Addgene plasmid # 43921 ; http://n2t.net/addgene:43921 ; RRID:Addgene_43921) -
For your References section:
Imaging trans-cellular neurexin-neuroligin interactions by enzymatic probe ligation. Liu DS, Loh KH, Lam SS, White KA, Ting AY. PLoS One. 2013;8(2):e52823. doi: 10.1371/journal.pone.0052823. Epub 2013 Feb 14. 10.1371/journal.pone.0052823 PubMed 23457442