This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

N111 nLV EF-1a-PGK-Puro Gal4-HP1a FL
(Plasmid #43968)


Item Catalog # Description Quantity Price (USD)
Plasmid 43968 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8600
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • Gal4/DBD (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N111 nLV EF-1a-PGK-Puro Gal4-HP1a FL was a gift from Jerry Crabtree (Addgene plasmid # 43968)
  • For your References section:

    Dynamics and memory of heterochromatin in living cells. Hathaway NA, Bell O, Hodges C, Miller EL, Neel DS, Crabtree GR. Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14. 10.1016/j.cell.2012.03.052 PubMed 22704655