pCYC2
(Plasmid
#43970)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43970 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonep416-CYC
- Backbone size (bp) 5500
-
Modifications to backboneInserted new multicloning site between CYC promoter and CYC terminator.
-
Vector typeBacterial Expression, Yeast Expression, Synthetic Biology
- Promoter CYC1
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tgttgtgtggaattgtgagc
- 3′ sequencing primer cgggcctcttcgctattacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCYC2 was a gift from Hal Alper (Addgene plasmid # 43970 ; http://n2t.net/addgene:43970 ; RRID:Addgene_43970) -
For your References section:
Re-engineering multicloning sites for function and convenience. Crook NC, Freeman ES, Alper HS. Nucleic Acids Res. 2011 Aug;39(14):e92. doi: 10.1093/nar/gkr346. Epub 2011 May 17. 10.1093/nar/gkr346 PubMed 21586584