Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGPD2
(Plasmid #43972)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 43972 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    p416-GPD
  • Backbone size (bp) 5500
  • Modifications to backbone
    Inserted new multicloning site between CYC promoter and CYC terminator.
  • Vector type
    Bacterial Expression, Yeast Expression, Synthetic Biology
  • Promoter GPD
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tgttgtgtggaattgtgagc
  • 3′ sequencing primer cgggcctcttcgctattacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGPD2 was a gift from Hal Alper (Addgene plasmid # 43972 ; http://n2t.net/addgene:43972 ; RRID:Addgene_43972)
  • For your References section:

    Re-engineering multicloning sites for function and convenience. Crook NC, Freeman ES, Alper HS. Nucleic Acids Res. 2011 Aug;39(14):e92. doi: 10.1093/nar/gkr346. Epub 2011 May 17. 10.1093/nar/gkr346 PubMed 21586584