pLKO-shcIAP1A
(Plasmid
#44129)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecIAP1
-
gRNA/shRNA sequenceGCCGAATTGTCTTTGGTGCTT
-
SpeciesH. sapiens (human)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRC clone ID: TRC0000003780
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shcIAP1A was a gift from William Hahn (Addgene plasmid # 44129 ; http://n2t.net/addgene:44129 ; RRID:Addgene_44129) -
For your References section:
IkappaB kinase epsilon phosphorylates TRAF2 to promote mammary epithelial cell transformation. Shen RR, Zhou AY, Kim E, Lim E, Habelhah H, Hahn WC. Mol Cell Biol. 2012 Dec;32(23):4756-68. doi: 10.1128/MCB.00468-12. Epub 2012 Sep 24. 10.1128/MCB.00468-12 PubMed 23007157