Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-shcIAP1-B
(Plasmid #44131)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44131 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    c-IAP1
  • Alt name
    BIRC2
  • gRNA/shRNA sequence
    GCTGCGGCCAACATCTTCAAA
  • Species
    H. sapiens (human)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TRC clone ID: TRC0000003782

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-shcIAP1-B was a gift from William Hahn (Addgene plasmid # 44131 ; http://n2t.net/addgene:44131 ; RRID:Addgene_44131)
  • For your References section:

    IkappaB kinase epsilon phosphorylates TRAF2 to promote mammary epithelial cell transformation. Shen RR, Zhou AY, Kim E, Lim E, Habelhah H, Hahn WC. Mol Cell Biol. 2012 Dec;32(23):4756-68. doi: 10.1128/MCB.00468-12. Epub 2012 Sep 24. 10.1128/MCB.00468-12 PubMed 23007157