This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCR2.1-ZFpparg
(Plasmid #44151)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44151 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR2.1-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3900
  • Total vector size (bp) 4659

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also Amp resistant
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Peroxisome proliferator-activated receptor gamma
  • Alt name
    pparg
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    759

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer GAAGATCCGTCTTCATCCTCAC
  • 3′ sequencing primer GATCTGTCCGTAGGAGATCAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Note from the depositor:This is intended for use in riboprobe synthesis, not for cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR2.1-ZFpparg was a gift from John Rawls (Addgene plasmid # 44151)
  • For your References section:

    Ontogeny and nutritional control of adipogenesis in zebrafish (Danio rerio). Flynn EJ 3rd, Trent CM, Rawls JF. J Lipid Res. 2009 Aug;50(8):1641-52. doi: 10.1194/jlr.M800590-JLR200. Epub 2009 Apr 14. 10.1194/jlr.M800590-JLR200 PubMed 19366995