K15-TK/pGL3
(Plasmid
#44267)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 9800
-
Modifications to backboneLuciferase replaced with HSV-1 TK from a TK/PBSIIKS plasmid by NotI/SalI digestion
-
Vector typeMammalian Expression, Mouse Targeting ; Thymidine kinase
-
Selectable markersThymidine Kinase (HSV-1 TK)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameK15 promoter (-4.8)
-
Alt nameKrt1-15 promoter
-
Alt namemouse keratin 15 promoter
-
Alt nameKrt15 keratin 15
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4961
-
MutationContains the murine K15 promoter (-4.8) fragment
-
GenBank IDNC_000077.6 AF542050
-
Entrez GeneKrt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
- Promoter murine K15 promoter (-4.8) fragment
-
Tag
/ Fusion Protein
- HSV-1 TK (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer RVprimer3
- 3′ sequencing primer pBR322ori-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternate plasmid name: K15-HSV-TK-pGL3
The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were
CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),
respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264).
The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase.
The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K15-TK/pGL3 was a gift from George Cotsarelis (Addgene plasmid # 44267 ; http://n2t.net/addgene:44267 ; RRID:Addgene_44267) -
For your References section:
Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Ito M, Liu Y, Yang Z, Nguyen J, Liang F, Morris RJ, Cotsarelis G. Nat Med. 2005 Dec;11(12):1351-4. Epub 2005 Nov 20. 10.1038/nm1328 PubMed 16288281
Map uploaded by the depositor.