-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44595 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 puro
-
Backbone manufacturerRobert Weinberg (Addgene plasmid #8453)
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRCA1
-
gRNA/shRNA sequenceAAACATGTCAGGAGCAGCAAT
-
SpeciesM. musculus (mouse)
-
Entrez GeneBrca1
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Observed knockdown = 85%
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shBRCA1 #2 was a gift from Eros Lazzerini Denchi (Addgene plasmid # 44595 ; http://n2t.net/addgene:44595 ; RRID:Addgene_44595) -
For your References section:
A two-step mechanism for TRF2-mediated chromosome-end protection. Okamoto K, Bartocci C, Ouzounov I, Diedrich JK, Yates Iii JR, Denchi EL. Nature. 2013 Feb 6. doi: 10.1038/nature11873. 10.1038/nature11873 PubMed 23389450