PRS415-Gal1pr-Mag1-sctetR
(Plasmid #44752)

• Depositing Lab: Narendra Maheshri
• Publication: Finney-Manchester et al Nucleic Acids Res. 2013 Mar 7.

Backbone

• Vector backbone: PRS415
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 8698
• Modifications to backbone: removed NgoMIV-KpnI fragment by blunt end ligation
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MAG1-sctetR
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2232
• Promoter: Gal1pr

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: None (destroyed during cloning)
• 5′ sequencing primer: CTCTATACTTTAACGTCAAGGAG
• 3′ sequencing primer: GAATGTAAGCGTGACATAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Leona Samson Professor, Department of Biological Engineering Massachusetts Institute of Technology

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene's sequencing results identified a few nucleotide differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing lab, these differences are not a concern for the function of the plasmid.