pGEN-MCS
(Plasmid
#44919)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEN
- Backbone size (bp) 5160
-
Modifications to backboneadded multiple cloning site
-
Vector typestable complementation
- Promoter none
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGCACTTGCTCACGCTCTG
- 3′ sequencing primer gtggtcacgcttttcgttgg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJames Galen University of Maryland
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
original source is pGEN222
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEN-MCS was a gift from Harry Mobley (Addgene plasmid # 44919 ; http://n2t.net/addgene:44919 ; RRID:Addgene_44919) -
For your References section:
Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Lane MC, Alteri CJ, Smith SN, Mobley HL. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007 Oct 9. 10.1073/pnas.0607898104 PubMed 17925449