-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBa-eGFP
- Backbone size w/o insert (bp) 6755
- Total vector size (bp) 9031
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTfR
-
Alt namehuman transferrin receptor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2276
-
GenBank IDM11507
-
Entrez GeneTFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
- Promoter Chicken Beta Actin
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKif 5c received from Caroine Enns, Oregon Health & Science University
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa.TfR.GFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 45060 ; http://n2t.net/addgene:45060 ; RRID:Addgene_45060) -
For your References section:
The role of selective transport in neuronal protein sorting. Burack MA, Silverman MA, Banker G. Neuron. 2000 May;26(2):465-72. 10.1016/S0896-6273(00)81178-2 PubMed 10839364