Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45189)


Item Catalog # Description Quantity Price (USD)
Plasmid 45189 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 9239
  • Total vector size (bp) 10793
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    enhanced Archaerhodopsin-3
  • Alt name
  • Species
    H. sodomense
  • Insert Size (bp)
  • Mutation
    D95N, D106E
  • Promoter CamKIIa
  • Tag / Fusion Protein
    • eYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctgacgaaggctcgcgaggc
  • 3′ sequencing primer gccatacgggaagcaatagcatg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that there may be several sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence which are consistant with the discrepancies in plasmid 35514. These changes are in vector regions only and should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Arch-EEN was a gift from Mark Schnitzer (Addgene plasmid # 45189 ; ; RRID:Addgene_45189)
  • For your References section:

    Enhanced Archaerhodopsin Fluorescent Protein Voltage Indicators. Gong Y, Li JZ, Schnitzer MJ. PLoS One. 2013 Jun 19;8(6):e66959. Print 2013. PubMed 23840563