Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #45381)

Item Catalog # Description Quantity Price (USD)
Plasmid 45381 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    changed mSrc Tyrosine 529 to Phenylalanine
  • Promoter CMV
  • Tags / Fusion Proteins
    • mCerulean (C terminal on insert)
    • Myc (C terminal on insert)
    • Myr (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUSE-Src-YF-UniRapR-mCerulean-myc was a gift from Klaus Hahn (Addgene plasmid # 45381)
  • For your References section:

    Rational design of a ligand-controlled protein conformational switch. Dagliyan O, Shirvanyants D, Karginov AV, Ding F, Fee L, Chandrasekaran SN, Freisinger CM, Smolen GA, Huttenlocher A, Hahn KM, Dokholyan NV. Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8. 10.1073/pnas.1218319110 PubMed 23569285