Plasmid 45381: pUSE-Src-YF-UniRapR-mCerulean-myc
  • Src-YF-UniRapR-mCerulean-myc

  • 2984

  • M. musculus (mouse)

  • mCerulean

  • C terminal on insert

  • Myc

  • C terminal on insert

  • Myr

  • N terminal on insert

  • changed mSrc Tyrosine 529 to Phenylalanine

  • pUSE
    (Search Vector Database)

  • Mammalian Expression

  • CMV

  • NheI

  • No

  • EcoRI

  • No

  • CGCAAATGGGCGGTAGGCGTG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (5)
  • View map

  • Klaus Hahn

  • Vanderbilt-Cerulean

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Rational design of a ligand-controlled protein conformational switch. Dagliyan et al (Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 45381" in your Materials and Methods section.