This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TRS6E1b-luc(-732/-721) WT
(Plasmid #45383)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 45383 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pGL2 Basic
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5600
  • Modifications to backbone
    E1bTATA inserted upstream of luciferase
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    6 copies of hPAI-1 promoter -732/-721
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Tag / Fusion Protein
    • luciferase

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TGTATCTTATGGTACTGTAACTG from Promega
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA from Promega
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRS6E1b-luc(-732/-721) WT was a gift from Thomas Gelehrter (Addgene plasmid # 45383 ; ; RRID:Addgene_45383)
  • For your References section:

    Smad4/DPC4 and Smad3 mediate transforming growth factor-beta (TGF-beta) signaling through direct binding to a novel TGF-beta-responsive element in the human plasminogen activator inhibitor-1 promoter. Song CZ, Siok TE, Gelehrter TD. J Biol Chem. 1998 Nov 6;273(45):29287-90. 10.1074/jbc.273.45.29287 PubMed 9792626