Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA5/FRT-HA-hM3D(Gq)
(Plasmid #45547)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45547 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5059
  • Total vector size (bp) 6832
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HA-hM3D
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1773
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer cctcgactgtgccttcta
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT-HA-hM3D(Gq) was a gift from Bryan Roth (Addgene plasmid # 45547)
  • For your References section:

    Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL. Proc Natl Acad Sci U S A. 2007 Mar 20;104(12):5163-8. Epub 2007 Mar 2. 10.1073/pnas.0700293104 PubMed 17360345