Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45549)


Item Catalog # Description Quantity Price (USD)
Plasmid 45549 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5026
  • Total vector size (bp) 6441
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer cctcgactgtgccttcta
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT-HA-rM3D(Gs) was a gift from Bryan Roth (Addgene plasmid # 45549 ; ; RRID:Addgene_45549)
  • For your References section:

    Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Armbruster BN, Li X, Pausch MH, Herlitze S, Roth BL. Proc Natl Acad Sci U S A. 2007 Mar 20;104(12):5163-8. Epub 2007 Mar 2. 10.1073/pnas.0700293104 PubMed 17360345