pCRII-Topo Gp88 in situ probe
(Plasmid #45628)

• Depositing Lab: Jeffrey Macklis
• Publication: Molyneaux et al J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009.

Backbone

• Vector backbone: pCRII-Topo
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 4514
• Vector type: in situ

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gpr88 in situ probe
• Alt name: Gpr88
• Alt name: G-protein coupled receptor 88
• Alt name: Strg
• Species: M. musculus (mouse)
• Insert Size (bp): 514
• Mutation: fragment contains bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427
• GenBank ID: NM_022427 AB042408.1
• Entrez Gene: Gpr88 (a.k.a. AW061286, Strg)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13 Rev, Sp6
• 3′ sequencing primer: T7, M13 Forward

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Gpr88 fragment was amplified by RT-PCR using the following primer pair:
CAAATGAAACCAATGGTCAGG
TATCTGTTTCCCGTGTCTCC

For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and Sp6 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 2742-3255 of AB042408.1 or bp# 2772-3285 of NM_022427, not bp# 2742-3255 of NM_022427 as indicated on plasmid map. The plasmid functions as described in the associated publication.