Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
(Plasmid #45764)


Item Catalog # Description Quantity Price (USD)
Plasmid 45764 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Bob Weinberg
  • Backbone size w/o insert (bp) 7032
  • Total vector size (bp) 7094
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • gRNA/shRNA sequence
  • Species
    H. sapiens (human)
  • Entrez Gene
    LINC-ROR (a.k.a. ROR, lincRNA-RoR, lincRNA-ST8SIA3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-lincRNA-RoR-sh1 (Linc-sh1) was a gift from George Daley (Addgene plasmid # 45764 ; ; RRID:Addgene_45764)
  • For your References section:

    Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells. Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, Garber M, Curran M, Onder T, Agarwal S, Manos PD, Datta S, Lander ES, Schlaeger TM, Daley GQ, Rinn JL. Nat Genet. 2010 Dec;42(12):1113-7. Epub 2010 Nov 7. 10.1038/ng.710 PubMed 21057500