pRS314-4M5.3
(Plasmid #45830)

• Depositing Lab: Dane Wittrup
• Publication: Yeast Secretion Vectors (unpublished)
• Price: $65 (USD)

Backbone

• Vector backbone: pRS314
  (Search Vector Database)
• Backbone size w/o insert (bp): 6190
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Sequence Information

• Depositor Sequences:
  Full (1)
• Addgene Sequences:
  Partial (3)

Gene/Insert

• Gene/Insert name: 4M5.3
• Insert Size (bp): 801
• Promoter: GAL1
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTGGGGTAATTAATCAGCGAAGCG
• 3′ sequencing primer: GTACGAGCTAAAAGTACAGTGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid pRS314 from PMID:2659436
• Terms and Licenses:
  • UBMTA