(Plasmid #45830)

Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone size w/o insert (bp) 6190
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter GAL1
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTGGGGTAATTAATCAGCGAAGCG
  • 3′ sequencing primer GTACGAGCTAAAAGTACAGTGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid pRS314 from PMID:2659436
  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS314-4M5.3 was a gift from Dane Wittrup (Addgene plasmid # 45830)