pRS314-4M5.3
(Plasmid #45830)

• Depositing Lab: Dane Wittrup
• Publication: Yeast Secretion Vectors (unpublished)
• Sequence Information:

  • Depositor Sequences: Full (1)
  • Addgene Sequences: Partial (3)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	45830	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pRS314
  (Search Vector Database)
• Backbone size w/o insert (bp): 6190
• Total vector size (bp): 6991
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4M5.3
• Insert Size (bp): 801
• Promoter: GAL1
• Tag / Fusion Protein:
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTGGGGTAATTAATCAGCGAAGCG
• 3′ sequencing primer: GTACGAGCTAAAAGTACAGTGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid pRS314 from PMID:2659436
• Terms and Licenses:
  • UBMTA