Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pRS314-4M5.3
(Plasmid #45830)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pRS314
  • Backbone size w/o insert (bp) 6190
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    4M5.3
  • Insert Size (bp)
    801
  • Promoter GAL1
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTGGGGTAATTAATCAGCGAAGCG
  • 3′ sequencing primer GTACGAGCTAAAAGTACAGTGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid pRS314 from PMID:2659436
  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS314-4M5.3 was a gift from Dane Wittrup (Addgene plasmid # 45830)