Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBADmod1-linker2-gamS
(Plasmid #45833)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45833 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD/His A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4292
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gamS
  • Alt name
    Lambda phage Gam
  • Species
    Lambda phage
  • Promoter pBAD
  • Tag / Fusion Protein
    • Histag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CAACTCTCTACTGTTTCTCCATAC
  • 3′ sequencing primer GATTTAATCTGTATCAGGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux, University of Minnesota
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBADmod1-linker2-gamS was a gift from Richard Murray & Vincent Noireaux (Addgene plasmid # 45833 ; http://n2t.net/addgene:45833 ; RRID:Addgene_45833)
  • For your References section:

    Linear DNA for rapid prototyping of synthetic biological circuits in an Escherichia coli based TX-TL cell-free system. Sun ZZ, Yeung E, Hayes CA, Noireaux V, Murray RM. ACS Synth Biol. 2014 Jun 20;3(6):387-97. doi: 10.1021/sb400131a. Epub 2013 Dec 4. 10.1021/sb400131a PubMed 24303785