Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

EHD2-T72A-mEGFP
(Plasmid #45934)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45934 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmEGFP-N-DEST
  • Backbone manufacturer
    Clontech/ custom-made
  • Backbone size w/o insert (bp) 4745
  • Total vector size (bp) 6374
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Eps-15 homology domain-containing protein2
  • Alt name
    EHD2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1629
  • Mutation
    T 72 changed to A (T72A)
  • GenBank ID
    NM_014601.3
  • Entrez Gene
    EHD2 (a.k.a. PAST2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mEGFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gttttcccagtcacgacgttgtaaaacgacggccagt
  • 3′ sequencing primer ccctatagtgagtcgtattacatggtcatagctgtttcctgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EHD2-T72A-mEGFP was a gift from Ari Helenius (Addgene plasmid # 45934 ; http://n2t.net/addgene:45934 ; RRID:Addgene_45934)
  • For your References section:

    Oligomers of the ATPase EHD2 confine caveolae to the plasma membrane through association with actin. Stoeber M, Stoeck IK, Hanni C, Bleck CK, Balistreri G, Helenius A. EMBO J. 2012 May 16;31(10):2350-64. doi: 10.1038/emboj.2012.98. Epub 2012 Apr 13. 10.1038/emboj.2012.98 PubMed 22505029