-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC-MUH
-
Backbone manufacturerBarret Pfeiffer
- Backbone size w/o insert (bp) 7800
- Total vector size (bp) 13300
-
Vector type10XUAS-phi31-expression vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUNC-84
-
Insert Size (bp)5500
-
MutationTwo amino acid mutations (F279L and L500P) compared to GenBank ref seq NP_001024707.1
-
Entrez Geneunc-84 (a.k.a. CELE_F54B11.3)
- Promoter 10XUAS
-
Tag
/ Fusion Protein
- 2XGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer MUHU2: ATAAACAAGCGCAGCTGAACAAGC
- 3′ sequencing primer MUHD1: AGAATGTTGAGAGTCAGCAGTAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMUH_unc84_2XGFP was a gift from Sean Eddy (Addgene plasmid # 46023 ; http://n2t.net/addgene:46023 ; RRID:Addgene_46023) -
For your References section:
Cell type-specific genomics of Drosophila neurons. Henry GL, Davis FP, Picard S, Eddy SR. Nucleic Acids Res. 2012 Oct;40(19):9691-704. doi: 10.1093/nar/gks671. Epub 2012 Aug 1. 10.1093/nar/gks671 PubMed 22855560