p201N 1514
(Plasmid #47025)

• Purpose: Contains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencing
• Depositing Lab: Wayne Parrott
• Publication: Jacobs et al Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362.

Backbone

• Vector backbone: pPZP
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 10626
• Modifications to backbone: Inclusion of aph gene for bacterial selection on kanamycin.
• Vector type: RNAi
• Selectable markers: G418, kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: gma-miR1514 recognition sequence
• Species: Glycine max
• Insert Size (bp): 22
• Promoter: GmUbi

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (destroyed during cloning)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGAGATTGCTTCAGATCCGTA
• 3′ sequencing primer: CCATTTCCATTTCACAGTTCG

Gene/Insert 2

• Gene/Insert name: nptII selectable marker
• Alt name: neomycin phosphotransferase II
• Species: Escherichia coli
• Insert Size (bp): 795
• Promoter: StUbi-3

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: AGCGGATAACAATTTCACACAGGA
• 3′ sequencing primer: GCAGAGCTTACACTCTCATTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The GmUbi promoter requires a license for distribution to commercial entities.

miRNA target sequence is: CAATGCCTATTTTAGAAATGAA