pMX-Brn4
(Plasmid
#47028)
-
PurposeExpresses mouse Brn4
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMX
- Backbone size w/o insert (bp) 5871
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBrn4
-
Alt namePou3f4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1085
-
MutationThe insert includes 40 bp of the TOPO vector in the 5 end
-
GenBank IDNM_008901
-
Entrez GenePou3f4 (a.k.a. Brn-4, Brn4, OTF-9, Otf9, Slf, oct-9)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer TCCCCCCTTTTTCTGGAGAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-Brn4 was a gift from Hans Schöler (Addgene plasmid # 47028 ; http://n2t.net/addgene:47028 ; RRID:Addgene_47028) -
For your References section:
Direct reprogramming of fibroblasts into neural stem cells by defined factors. Han DW, Tapia N, Hermann A, Hemmer K, Hoing S, Arauzo-Bravo MJ, Zaehres H, Wu G, Frank S, Moritz S, Greber B, Yang JH, Lee HT, Schwamborn JC, Storch A, Scholer HR. Cell Stem Cell. 2012 Apr 6;10(4):465-72. doi: 10.1016/j.stem.2012.02.021. Epub 2012 Mar 22. 10.1016/j.stem.2012.02.021 PubMed 22445517