This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFYF1327 EGFP Site#2
(Plasmid #47512)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47512 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MLM3636
  • Backbone manufacturer
    Joung lab (Addgene plasmid #43860)
  • Backbone size w/o insert (bp) 2278
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA-EGFP site 2
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Target site: GATGCCGTTCTTCTGCTTGT

gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)

For more information on Joung Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/jounglab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFYF1327 EGFP Site#2 was a gift from Keith Joung (Addgene plasmid # 47512 ; http://n2t.net/addgene:47512 ; RRID:Addgene_47512)
  • For your References section:

    High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK, Sander JD. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. 10.1038/nbt.2623 PubMed 23792628