Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #47515)


Item Catalog # Description Quantity Price (USD)
Plasmid 47515 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Integrin alpha2B L980A TM-CYTO
  • Species
  • Insert Size (bp)
  • Promoter Trc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gcgctgaagtcttacgagga
  • 3′ sequencing primer TTATGACAACTTGACGGCTACATC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The Addgene QC sequence identifed a S23P mutation in the MBP insert that does not effect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAraTMDN was a gift from Bryan Berger (Addgene plasmid # 47515 ; ; RRID:Addgene_47515)
  • For your References section:

    A Novel Assay for Assessing Juxtamembrane and Transmembrane Domain Interactions Important for Receptor Heterodimerization. Su PC, Berger BW. J Mol Biol. 2013 Jul 19. pii: S0022-2836(13)00456-7. doi: 10.1016/j.jmb.2013.07.022. 10.1016/j.jmb.2013.07.022 PubMed 23876708