-
PurposeExpresses CAS9 nuclease in mammalian cells. Used to modify genome of mouse embroys
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Total vector size (bp) 9293
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimized Cas9
-
Alt namehCAS9
-
Alt nameT3-FLAG-NLS-CAS9-NLS-polyA
-
SpeciesSynthetic
-
Insert Size (bp)4218
- Promoter CAG promoter
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- polyA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGTCCCCTTCTCCCTCTC
- 3′ sequencing primer ATTTTTGGCAGAGGGAAAAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SV40 nuclear localization signals (NLS) were added to the N- and C-terminus of Cas9 by PCR using NLS-coding primers. The NLS flanked Cas9 was inserted into the BglII-Acc65I site of ZFN-platform vector to add a T3 promoter, FLAG-tag and the Tbpl1 3′UTR containing a 95 bp polyA tail. The sequence from the T3 promoter to the polyA tail was cloned by PCR and inserted into the EcoRI site of the pCAGGS vector.
For the in vitro synthesis of CAS9 mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.
The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.
The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-T3-hCAS-pA was a gift from Wataru Fujii & Kunihiko Naito (Addgene plasmid # 48625 ; http://n2t.net/addgene:48625 ; RRID:Addgene_48625) -
For your References section:
Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Fujii W, Kawasaki K, Sugiura K, Naito K. Nucleic Acids Res. 2013 Aug 30. 10.1093/nar/gkt772 PubMed 23997119