CeCollectrin-like pXOOM
(Plasmid #48704)

• Purpose: Encodes the Caenorhabditis elegans Collectrin homologue for expressing in Xenopus Oocytes of Mammalian cells
• Depositing Lab: Dmitri Boudko
• Publication: CeCollectrin-like pXOOM (unpublished)

Backbone

• Vector backbone: pXOOM
• Backbone size w/o insert (bp): 5052
• Total vector size (bp): 5478
• Vector type: Mammalian Expression ; Xenopus Oocyte Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: NM_058858
• Species: C. elegans (nematode)
• Entrez Gene: C50F2.7 (a.k.a. CELE_C50F2.7)
• Promoter: t7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ATGAGACTTTCCGTTTTATTCT
• 3′ sequencing primer: TCACTGATACGCAGTGTATGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original plasmid backbone (pXOOM) was donated by the laboratory of Dr. Thomas Jespersen from the University of Copenhagen, Denmark.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry