CeCollectrin-like pXOOM
(Plasmid
#48704)
-
PurposeEncodes the Caenorhabditis elegans Collectrin homologue for expressing in Xenopus Oocytes of Mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXOOM
- Backbone size w/o insert (bp) 5052
- Total vector size (bp) 5478
-
Vector typeMammalian Expression ; Xenopus Oocyte Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNM_058858
-
SpeciesC. elegans (nematode)
-
Entrez GeneC50F2.7 (a.k.a. CELE_C50F2.7)
- Promoter t7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATGAGACTTTCCGTTTTATTCT
- 3′ sequencing primer TCACTGATACGCAGTGTATGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original plasmid backbone (pXOOM) was donated by the laboratory of Dr. Thomas Jespersen from the University of Copenhagen, Denmark.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CeCollectrin-like pXOOM was a gift from Dmitri Boudko (Addgene plasmid # 48704 ; http://n2t.net/addgene:48704 ; RRID:Addgene_48704)