3xFNLDD/pMXs-I2
(Plasmid #48880)

• Purpose: Expresses 3xFNLDD in mammalian cells
• Depositing Lab: Hodaka Fujii
• Publication: Fujita et al PLoS One. 2015 Jan 21;10(1):e0116579. doi: 10.1371/journal.pone.0116579. eCollection 2015.

Backbone

• Vector backbone: pMXs-I2
• Backbone manufacturer: Hodaka Fujii
• Backbone size w/o insert (bp): 6360
• Total vector size (bp): 7107
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: human CD2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xFNLDD
• Alt name: 3xFLAG-NLS-LexA binding domain
• Species: Synthetic
• Insert Size (bp): 747
• Promoter: LTR
• Tags / Fusion Proteins:
  • 3xFLAG tag (N terminal on insert)
  • NLS (nuclear localization signal) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR I (destroyed during cloning)
• 3′ cloning site: Not I (destroyed during cloning)
• 5′ sequencing primer: ggtggaccatcctctagact
• 3′ sequencing primer: AAACGCACACCGGCCTTATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is described in the following article:

Efficient isolation of specific genomic regions by insertional chromatin immunoprecipitation (iChIP) with a second-generation tagged LexA DNA-binding domain.

Toshitsugu Fujita, Hodaka Fujii

Advances in Bioscience and Biotechnology, 2013
DOI: 10.4236/abb.2012.35081

http://www.scirp.org/journal/PaperInformation.aspx?paperID=22552

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/