pC1-FGB (FlincG2)
(Plasmid
#49204)
-
PurposeFluorescent reporter for cGMP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1 vector
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4044
- Total vector size (bp) 5664
-
Modifications to backboneThe native EGFP was deleted first and then the PCR amplified FlincG2 was cloned at Nhe I and Xho I sites.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlincG2
-
Alt nameFGB
-
Alt nameCR4-C1
-
SpeciesB. taurus (bovine); GFP
-
Insert Size (bp)1620
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CAACTCCGCCCCATTGACGC
- 3′ sequencing primer None (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProf. Wolfgang Dostmann at University of Vermont, USA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-FGB (FlincG2) was a gift from John Garthwaite (Addgene plasmid # 49204 ; http://n2t.net/addgene:49204 ; RRID:Addgene_49204) -
For your References section:
Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging. Bhargava Y, Hampden-Smith K, Chachlaki K, Wood KC, Vernon J, Allerston CK, Batchelor AM, Garthwaite J. Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026. 10.3389/fnmol.2013.00026 PubMed 24068983