-
Purposeexpression of gRNA under control of the Drosophila U6:3 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 49410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepValium22
-
Backbone manufacturerNorbert Perrimon, Jian-Quan Ni, Harvard
- Total vector size (bp) 6248
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedU6-3:gRNA
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)750
- Promoter dU6-3
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACCTACTCAGCCAAGAGGC
- 3′ sequencing primer TGCATACGCATTAAGCGAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFillip Port, Simon Bullock lab, MRC-LMB
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
Please acknowledge Fillip Port and Simon Bullock when publishing work derived from use of this plasmid.
Visit crisprflydesign.org for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-dU6:3gRNA was a gift from Simon Bullock (Addgene plasmid # 49410 ; http://n2t.net/addgene:49410 ; RRID:Addgene_49410) -
For your References section:
Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Port F, Chen HM, Lee T, Bullock SL. Proc Natl Acad Sci U S A. 2014 Jul 7. pii: 201405500. 10.1073/pnas.1405500111 PubMed 25002478