-
Purposeexpresses EGFP-Rab4AQ67L (constitutively active mutant) in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5300
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab4AQ67L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)650
-
MutationGlutamine 67 to Leucine**
-
GenBank IDAF498934
-
Entrez GeneRAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypurchased from Missouri S&T cDNA Resource Center (cDNA.org) pCDNA3.1+Rab4A
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Quick Change mutagenesis
** Note, this mutation corresponds to Q72L in the full length Rab4A
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab4AQ67L was a gift from Marci Scidmore (Addgene plasmid # 49475) -
For your References section:
The GTPase Rab4 interacts with Chlamydia trachomatis inclusion membrane protein CT229. Rzomp KA, Moorhead AR, Scidmore MA. Infect Immun. 2006 Sep;74(9):5362-73. 10.1128/IAI.00539-06 PubMed 16926431