EGFP-Rab6AT27N
(Plasmid #49484)

• Purpose: expresses EGFP-Rab6AT27N (Dominant Negative mutant) in mammalian cells)
• Depositing Lab: Marci Scidmore
• Publication: Moorhead et al Infect Immun. 2007 Feb;75(2):781-91. Epub 2006 Nov 13.

Backbone

• Vector backbone: EGFP C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5320
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab6AT27N
• Species: H. sapiens (human)
• Insert Size (bp): 627
• Mutation: Threonine 27 to Asparagine
• GenBank ID:
• Entrez Gene: RAB6A (a.k.a. RAB6)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI/BglII (destroyed during cloning)
• 3′ cloning site: XhoI/SalI (destroyed during cloning)
• 5′ sequencing primer: EGFP C (CATGGTCCTGCTGGAGTTCGTG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: purchased pCDNA3.1+Rab6A from Missouri S&T cDNA Resource Center (cDNA.org). Quick Change mutagenesis
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry