GBK-Rab1AQ70LdeltaCC
(Plasmid #49555)

• Purpose: expresses GAL4BD-Rab1AQ70Ldelta CC in yeast
• Depositing Lab: Marci Scidmore
• Publication: Cortes et al Infect Immun. 2007 Dec;75(12):5586-96. Epub 2007 Oct 1.

Backbone

• Vector backbone: GBK-T7
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7300
• Total vector size (bp): 7900
• Vector type: Yeast Expression
• Selectable markers: Neomycin (select with G418), TRP1

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rab1AQ70L
• Species: H. sapiens (human)
• Mutation: Glutamine 70 to Leucine, deleted amino acids Cysteine 204 and Cysteine 205
• GenBank ID: NM_004161
• Entrez Gene: RAB1A (a.k.a. RAB1, YPT1)
• Promoter: ADHI
• Tags / Fusion Proteins:
  • Gal4 Binding Domain (N terminal on insert)
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI/SalI (destroyed during cloning)
• 5′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Rab1A cDNA derived from pCDNA3.1+Rab1A purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry