GST-Rab4A
(Plasmid
#49566)
-
Purposeexpresses GST-Rab4A in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-4T-1
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 5400
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab4A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
GenBank IDAF498934
-
Entrez GeneRAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
- Promoter tac inducible with IPTG
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pGEX Fwd (GGGCTGGCAAGCCACGTTTGGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab4A generated from pCDNA3.1+Rab4A purchased from Missouri S&T cDNA Resource Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GST-Rab4A was a gift from Marci Scidmore (Addgene plasmid # 49566) -
For your References section:
Chlamydia pneumoniae inclusion membrane protein Cpn0585 interacts with multiple Rab GTPases. Cortes C, Rzomp KA, Tvinnereim A, Scidmore MA, Wizel B. Infect Immun. 2007 Dec;75(12):5586-96. Epub 2007 Oct 1. 10.1128/IAI.01020-07 PubMed 17908815