pCDM4-GLY
(Plasmid #49808)

• Purpose: Encodes pgk, gapA, aceE, aceF, lpdA in pseudo-operon configuration.
• Depositing Lab: Mattheos Koffas
• Publication: Xu et al Nat Commun. 2013;4:1409. doi: 10.1038/ncomms2425.

Backbone

• Vector backbone: pCDM4
• Backbone size w/o insert (bp): 3810
• Total vector size (bp): 12630
• Modifications to backbone: See paper.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: phosphoglycerate kinase
• Alt name: pgk
• Species: Escherichia coli
• Insert Size (bp): 1164
• GenBank ID: CDJ73916.1
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTCTGTAATTAAGATGACCGATCTGG
• 3′ sequencing primer: CTTCTTAGCGCGCTCTTCG

Gene/Insert 2

• Gene/Insert name: glyceraldehyde-3-phosphate dehydrogenase
• Alt name: gapA
• Species: E. coli K-12
• Insert Size (bp): 996
• GenBank ID: CDJ72173.1
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTAGGTATCAACGGTTTTGGCC
• 3′ sequencing primer: GGAGATGTGAGCGATCAGGTC

Gene/Insert 3

• Gene/Insert name: pyruvate dehydrogenase subunit E1
• Alt name: aceE
• Species: E. coli K-12
• Insert Size (bp): 2664
• GenBank ID: CDJ70695.1
• Promoter: T7

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTCAGAACGTTTCCCAAATGACG
• 3′ sequencing primer: CCAGACGCGGGTTAACTTTATC

Gene/Insert 4

• Gene/Insert name: dihydrolipoamide acetyltransferase
• Alt name: aceF
• Species: E. coli
• Insert Size (bp): 1893
• GenBank ID: CDJ70696.1
• Promoter: T7

Cloning Information for Gene/Insert 4

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GGCTATCGAAATCAAAGTACC
• 3′ sequencing primer: CATCACCAGACGGCGAATG

Gene/Insert 5

• Gene/Insert name: dihydrolipoamide dehydrogenase
• Alt name: lpdA
• Species: E. coli K-12
• Insert Size (bp): 1145
• GenBank ID: CDJ70697.1
• Promoter: T7

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CTCAGGTCGTGGTACTTGG
• 3′ sequencing primer: CTTCTTCTTCGCTTTCGGGTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry